Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 1790305
End position: 1790328
Length: 24

DNA sequence
>NC_015588, from 1790305 to 1790328 (24 bp); Isoptericola variabilis 225 CCTCGACGTCGACCTCGACCTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1790190-1790948	Sequence	Isova_1656 - hypothetical protein (Protein is coded in complementary strand; from 1790948 to 1790190)