Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 1827164
End position: 1827187
Length: 24

DNA sequence
>NC_015588, from 1827164 to 1827187 (24 bp); Isoptericola variabilis 225 GCTCGAGGTCGAGCCCGAGCTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1826965-1828824	Sequence	Isova_1695 - Na(+)/H(+) antiporter NhaA (Protein is coded in complementary strand; from 1828824 to 1826965)