Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 1877784
End position: 1877813
Length: 30

DNA sequence
>NC_015588, from 1877784 to 1877813 (30 bp); Isoptericola variabilis 225 GCGCCCGCGCGCGGCCTCGCGCGCCCGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1877560-1878183	Sequence	Isova_1741 - bifunctional deaminase-reductase domain-containing protein (Protein is coded in complementary strand; from 1878183 to 1877560)