Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 1925028
End position: 1925063
Length: 36

DNA sequence
>NC_015588, from 1925028 to 1925063 (36 bp); Isoptericola variabilis 225 CGGCGACGAGCGCGGCGGCGACCGACGCGACGAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1924475-1925194	Sequence	Isova_1780 - hypothetical protein (Protein is coded in complementary strand; from 1925194 to 1924475)