Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 1951234
End position: 1951263
Length: 30

DNA sequence
>NC_015588, from 1951234 to 1951263 (30 bp); Isoptericola variabilis 225 CGCGCGCCGGCTCGCGCCCGCGCTCGACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1951203-1952597	Sequence	Isova_1805 - FAD linked oxidase domain-containing protein