Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 19669
End position: 19710
Length: 42

DNA sequence
>NC_015588, from 19669 to 19710 (42 bp); Isoptericola variabilis 225 TCGCCGTCGCCGTCCCCGTCACCGTCGCCCCCGCCGTTGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 19624-21717	Sequence	Isova_0019 - serine/threonine protein kinase with PASTA sensor(s) (Protein is coded in complementary strand; from 21717 to 19624)