Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 200027
End position: 200062
Length: 36

DNA sequence
>NC_015588, from 200027 to 200062 (36 bp); Isoptericola variabilis 225 CGCCGCGAGCGCCGCCGCGAGCGCCGCGGCGACCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 199488-200429	Sequence	Isova_0183 - V8-like Glu-specific endopeptidase (Protein is coded in complementary strand; from 200429 to 199488)