Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 205094
End position: 205117
Length: 24

DNA sequence
>NC_015588, from 205094 to 205117 (24 bp); Isoptericola variabilis 225 GCCGGAGTCGGAGCCGGAGCCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 204360-205184	Sequence	Isova_0188 - ABC transporterer periplasmic protein (Protein is coded in complementary strand; from 205184 to 204360)