Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2113730
End position: 2113783
Length: 54

DNA sequence
>NC_015588, from 2113730 to 2113783 (54 bp); Isoptericola variabilis 225 CGTCGAGCACGCCGCGGACGGCGCGCACGCCGCGGACGGCGCGCACGCCGAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2113348-2114364	Sequence	Isova_1959 - metal ion ABC transporter periplasmic protein