Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2170012
End position: 2170047
Length: 36

DNA sequence
>NC_015588, from 2170012 to 2170047 (36 bp); Isoptericola variabilis 225 GCTCTTGCCCTTGCTCGTGCTCTTGCTCGTGCTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2169953-2170921	Sequence	Isova_2007 - DNA repair protein (Protein is coded in complementary strand; from 2170921 to 2169953)