Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2227112
End position: 2227138
Length: 27

DNA sequence
>NC_015588, from 2227112 to 2227138 (27 bp); Isoptericola variabilis 225 TGCCGCCGTCGCCGCCGTTGCCGCCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2225722-2227245	Sequence	Isova_2065 - GTPase obg (Protein is coded in complementary strand; from 2227245 to 2225722)