Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2236115
End position: 2236141
Length: 27

DNA sequence
>NC_015588, from 2236115 to 2236141 (27 bp); Isoptericola variabilis 225 ACGACGGCGGCGACGGCGACGACGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2234205-2237534	Sequence	Isova_2074 - ribonuclease, Rne/Rng family (Protein is coded in complementary strand; from 2237534 to 2234205)