Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 227316
End position: 227339
Length: 24

DNA sequence
>NC_015588, from 227316 to 227339 (24 bp); Isoptericola variabilis 225 TGGCGATCGCGACGGCGATCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 227117-228241	Sequence	Isova_0214 - arsenical-resistance protein (Protein is coded in complementary strand; from 228241 to 227117)