Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2339945
End position: 2339968
Length: 24

DNA sequence
>NC_015588, from 2339945 to 2339968 (24 bp); Isoptericola variabilis 225 TGCTGCTGCTGGTGGTGCTGCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2338831-2339973	Sequence	Isova_2177 - branched-chain amino acid aminotransferase (Protein is coded in complementary strand; from 2339973 to 2338831)