Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2343536
End position: 2343559
Length: 24

DNA sequence
>NC_015588, from 2343536 to 2343559 (24 bp); Isoptericola variabilis 225 TCGGCCTCGGCCACGGCCTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2342732-2343760	Sequence	Isova_2181 - ketol-acid reductoisomerase (Protein is coded in complementary strand; from 2343760 to 2342732)