Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 241075
End position: 241098
Length: 24

DNA sequence
>NC_015588, from 241075 to 241098 (24 bp); Isoptericola variabilis 225 CGCGGCCGCCGCCGCGGGCTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 240980-241606	Sequence	Isova_0227 - ribonuclease H (Protein is coded in complementary strand; from 241606 to 240980)