Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2418534
End position: 2418557
Length: 24

DNA sequence
>NC_015588, from 2418534 to 2418557 (24 bp); Isoptericola variabilis 225 GACGTCGACGGCGCCGTCGGCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2416984-2418645	Sequence	Isova_2229 - nitrite reductase (NAD(P)H) (Protein is coded in complementary strand; from 2418645 to 2416984)