Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2469253
End position: 2469276
Length: 24

DNA sequence
>NC_015588, from 2469253 to 2469276 (24 bp); Isoptericola variabilis 225 GTCCGGGTCGGGGTCGGGGGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2468207-2470228	Sequence	Isova_2273 - oligopeptide/dipeptide ABC transporter ATPase (Protein is coded in complementary strand; from 2470228 to 2468207)