Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2474686
End position: 2474709
Length: 24

DNA sequence
>NC_015588, from 2474686 to 2474709 (24 bp); Isoptericola variabilis 225 GTGGTCGTGGTCGTGGTCGTGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2473514-2474719	Sequence	Isova_2276 - agmatinase (Protein is coded in complementary strand; from 2474719 to 2473514)