Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 24771
End position: 24800
Length: 30

DNA sequence
>NC_015588, from 24771 to 24800 (30 bp); Isoptericola variabilis 225 GCGTGGCCCCGCGGGGCGCCACCTGGCCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 24608-26170	Sequence	Isova_0022 - cell cycle protein (Protein is coded in complementary strand; from 26170 to 24608)