Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2485131
End position: 2485154
Length: 24

DNA sequence
>NC_015588, from 2485131 to 2485154 (24 bp); Isoptericola variabilis 225 CCGCGCCCGTGCTCGCGCCCGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2484809-2486203	Sequence	Isova_2286 - beta-lactamase (Protein is coded in complementary strand; from 2486203 to 2484809)