Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 251658
End position: 251681
Length: 24

DNA sequence
>NC_015588, from 251658 to 251681 (24 bp); Isoptericola variabilis 225 CGATGAAGATGACGATGCCGAGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 250430-252031	Sequence	Isova_0236 - Na+/H+ antiporter NhaC-like protein (Protein is coded in complementary strand; from 252031 to 250430)