Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2595256
End position: 2595291
Length: 36

DNA sequence
>NC_015588, from 2595256 to 2595291 (36 bp); Isoptericola variabilis 225 GACGTCGTCGACGTGGTCGACGTGGTCGACGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2594879-2595748	Sequence	Isova_2379 - inositol monophosphatase (Protein is coded in complementary strand; from 2595748 to 2594879)