Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 269032
End position: 269079
Length: 48

DNA sequence
>NC_015588, from 269032 to 269079 (48 bp); Isoptericola variabilis 225 ACCCCCGCTCCCACCCCCGCTCCCACCCCCGCTCCCACCCCCGCTCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 268631-270109	Sequence	Isova_0255 - dihydrolipoyllysine-residue acetyltransferase