Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2708145
End position: 2708168
Length: 24

DNA sequence
>NC_015588, from 2708145 to 2708168 (24 bp); Isoptericola variabilis 225 TCGGCACCGGCACCGGCACCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2707683-2708549	Sequence	Isova_2476 - LysR substrate-binding protein (Protein is coded in complementary strand; from 2708549 to 2707683)