Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2728932
End position: 2728967
Length: 36

DNA sequence
>NC_015588, from 2728932 to 2728967 (36 bp); Isoptericola variabilis 225 ACGGGGAGGGCGACGGTGAGGACGACGGCGAGGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2728931-2729431	Sequence	Isova_2496 - septum formation initiator (Protein is coded in complementary strand; from 2729431 to 2728931)