Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2746080
End position: 2746103
Length: 24

DNA sequence
>NC_015588, from 2746080 to 2746103 (24 bp); Isoptericola variabilis 225 GCTCGAGGTCGAGCACGAGGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2744840-2746207	Sequence	Isova_2511 - L-lysine 6-transaminase (Protein is coded in complementary strand; from 2746207 to 2744840)