Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2753851
End position: 2753874
Length: 24

DNA sequence
>NC_015588, from 2753851 to 2753874 (24 bp); Isoptericola variabilis 225 CGACGAGGACGACGAGGACGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2753588-2754739	Sequence	Isova_2518 - transglycosylase-like domain protein (Protein is coded in complementary strand; from 2754739 to 2753588)