Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2766328
End position: 2766351
Length: 24

DNA sequence
>NC_015588, from 2766328 to 2766351 (24 bp); Isoptericola variabilis 225 GCGGCGGCCGCGGCGGAGGCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2765029-2766627	Sequence	Isova_2528 - hypothetical protein (Protein is coded in complementary strand; from 2766627 to 2765029)