Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2767865
End position: 2767888
Length: 24

DNA sequence
>NC_015588, from 2767865 to 2767888 (24 bp); Isoptericola variabilis 225 GCGGCGGCCGCGGCGACGGCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2767676-2768881	Sequence	Isova_2530 - hypothetical protein (Protein is coded in complementary strand; from 2768881 to 2767676)