Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2775275
End position: 2775298
Length: 24

DNA sequence
>NC_015588, from 2775275 to 2775298 (24 bp); Isoptericola variabilis 225 CGTCGTCCTCGTCGTCCTCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2775247-2779383	Sequence	Isova_2537 - hypothetical protein (Protein is coded in complementary strand; from 2779383 to 2775247)