Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2804961
End position: 2805023
Length: 63

DNA sequence
>NC_015588, from 2804961 to 2805023 (63 bp); Isoptericola variabilis 225 CGTCGTCGGGCCGCGCCCCGGAGTCGTCGGGCCGCGTCCCGGAGTCGTCCGGCCCCGTCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2804675-2805355	Sequence	Isova_2560 - hypothetical protein (Protein is coded in complementary strand; from 2805355 to 2804675)