Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2814869
End position: 2814892
Length: 24

DNA sequence
>NC_015588, from 2814869 to 2814892 (24 bp); Isoptericola variabilis 225 CGTCGCCGTCGCCGTCCCCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2814565-2815956	Sequence	Isova_2572 - beta-lactamase (Protein is coded in complementary strand; from 2815956 to 2814565)