Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2822087
End position: 2822116
Length: 30

DNA sequence
>NC_015588, from 2822087 to 2822116 (30 bp); Isoptericola variabilis 225 GCTCCGGCTCCGGCTCGGGCTCGGGCTCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2821645-2822466	Sequence	Isova_2579 - NLP/P60 protein (Protein is coded in complementary strand; from 2822466 to 2821645)