Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2849487
End position: 2849516
Length: 30

DNA sequence
>NC_015588, from 2849487 to 2849516 (30 bp); Isoptericola variabilis 225 CGCGAGGGCGAGCGTGAGCGCGAGCGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2849239-2850144	Sequence	Isova_2604 - hypothetical protein (Protein is coded in complementary strand; from 2850144 to 2849239)