Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2902568
End position: 2902591
Length: 24

DNA sequence
>NC_015588, from 2902568 to 2902591 (24 bp); Isoptericola variabilis 225 GCGACGGCGTCGGCGACCGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2900846-2902876	Sequence	Isova_2656 - ATP-dependent metalloprotease FtsH (Protein is coded in complementary strand; from 2902876 to 2900846)