Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2915373
End position: 2915408
Length: 36

DNA sequence
>NC_015588, from 2915373 to 2915408 (36 bp); Isoptericola variabilis 225 CGTACGACCCGTACGACCCGTACGACCCGTACGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2915066-2916802	Sequence	Isova_2668 - hypothetical protein (Protein is coded in complementary strand; from 2916802 to 2915066)