Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 2987972
End position: 2987995
Length: 24

DNA sequence
>NC_015588, from 2987972 to 2987995 (24 bp); Isoptericola variabilis 225 AGCCCGAGCCCCAGCGCGAGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2987432-2988088	Sequence	Isova_2737 - ABC transporter (Protein is coded in complementary strand; from 2988088 to 2987432)