Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 3078788
End position: 3078811
Length: 24

DNA sequence
>NC_015588, from 3078788 to 3078811 (24 bp); Isoptericola variabilis 225 GTCGGCGTCGGAGCCGGCGTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3078608-3078973	Sequence	Isova_2815 - lipoprotein (Protein is coded in complementary strand; from 3078973 to 3078608)