Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 3085074
End position: 3085100
Length: 27

DNA sequence
>NC_015588, from 3085074 to 3085100 (27 bp); Isoptericola variabilis 225 GCAGCACGAGCAGCCCGAGCACCACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3084308-3086041	Sequence	Isova_2823 - ABC transporter (Protein is coded in complementary strand; from 3086041 to 3084308)