Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 3116074
End position: 3116109
Length: 36

DNA sequence
>NC_015588, from 3116074 to 3116109 (36 bp); Isoptericola variabilis 225 TCCGCCGCCGCCTTCACCGCCGCCACCGCCACCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3114821-3116224	Sequence	Isova_2845 - extracellular solute-binding protein (Protein is coded in complementary strand; from 3116224 to 3114821)