Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 318413
End position: 318436
Length: 24

DNA sequence
>NC_015588, from 318413 to 318436 (24 bp); Isoptericola variabilis 225 CTCGGGCTCGGGCTGGGGCTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 317918-318652	Sequence	Isova_0299 - hypothetical protein (Protein is coded in complementary strand; from 318652 to 317918)