Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 3219286
End position: 3219309
Length: 24

DNA sequence
>NC_015588, from 3219286 to 3219309 (24 bp); Isoptericola variabilis 225 CCGCGACGGCGACCGCGACCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3218661-3220013	Sequence	Isova_2935 - sigma-70 region 4 type 2 (Protein is coded in complementary strand; from 3220013 to 3218661)