Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 3245711
End position: 3245737
Length: 27

DNA sequence
>NC_015588, from 3245711 to 3245737 (27 bp); Isoptericola variabilis 225 GTGCTGGTGGTGCTCGTGGTGCTGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3243666-3245765	Sequence	Isova_2965 - copper-translocating P-type ATPase (Protein is coded in complementary strand; from 3245765 to 3243666)