Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 3281529
End position: 3281591
Length: 63

DNA sequence
>NC_015588, from 3281529 to 3281591 (63 bp); Isoptericola variabilis 225 CCCGCCGCCGTTGCCGTCACCACCGCCGCCGTCGCCGTCACCACCGTCGCCGTTGCCGTTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3281500-3284013	Sequence	Isova_3000 - peptidoglycan glycosyltransferase (Protein is coded in complementary strand; from 3284013 to 3281500)