Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 3305556
End position: 3305579
Length: 24

DNA sequence
>NC_015588, from 3305556 to 3305579 (24 bp); Isoptericola variabilis 225 TGTCGAGGTCGATGTCGCCGTCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3305174-3305716	Sequence	Isova_3017 - single-stranded nucleic acid binding R3H domain-containing protein (Protein is coded in complementary strand; from 3305716 to 3305174)