Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 34971
End position: 35006
Length: 36

DNA sequence
>NC_015588, from 34971 to 35006 (36 bp); Isoptericola variabilis 225 CGCGGGCTCCGGCTCCGGCTCCGGCTCGGGCTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 34879-36021	Sequence	Isova_0032 - alpha/beta hydrolase fold protein (Protein is coded in complementary strand; from 36021 to 34879)