Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 414470
End position: 414505
Length: 36

DNA sequence
>NC_015588, from 414470 to 414505 (36 bp); Isoptericola variabilis 225 CTCGGTGGACGGCTCGGTGCTCGGCTCGGTGGACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 413937-414824	Sequence	Isova_0395 - hypothetical protein (Protein is coded in complementary strand; from 414824 to 413937)