Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 480176
End position: 480208
Length: 33

DNA sequence
>NC_015588, from 480176 to 480208 (33 bp); Isoptericola variabilis 225 ACGCGCGCCGCACGGGCGTCGCCCGCGAGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 480113-480886	Sequence	Isova_0453 - IclR family transcriptional regulator (Protein is coded in complementary strand; from 480886 to 480113)