Sequence retrieval

Genome: Isoptericola variabilis 225
Start position: 732216
End position: 732239
Length: 24

DNA sequence
>NC_015588, from 732216 to 732239 (24 bp); Isoptericola variabilis 225 GCGCGAGCGCGGGCCCGAGCGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 731728-732495	Sequence	Isova_0687 - ROK family protein (Protein is coded in complementary strand; from 732495 to 731728)